Stem-loop sequence cfa-mir-106b

AccessionMI0008109 (change log)
DescriptionCanis familiaris miR-106b stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   --ua       g       a -aua    u 
5'     aagugcu acagugc g    gcgg c
       ||||||| ||||||| |    ||||  
3'     uucaugg ugucacg c    ugcc c
   gucg       g       c aucg    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr6: 9498558-9498616 [+]
sense
ENSCAFT00000023450 ; MCM7-201; intron 13
Clustered miRNAs
< 10kb from cfa-mir-106b
cfa-mir-106bchr6: 9498558-9498616 [+]
cfa-mir-93chr6: 9498780-9498840 [+]
cfa-mir-25chr6: 9498993-9499051 [+]
Database links

Mature sequence cfa-miR-106b

Accession MIMAT0006695
Sequence

1 - 

uaaagugcugacagugcagau

 - 21

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).