Stem-loop sequence cfa-mir-98

AccessionMI0008182 (change log)
DescriptionCanis familiaris miR-98 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   --u                 u    ---------      aggg 
5'    gagguaguaaguuguau guug         uggggu    a
      ||||||||||||||||| ||||         ||||||    u
3'    uuucaucauucaacaua caau         accccg    u
   ccc                 u    agaagauua      gauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chrX: 45253693-45253772 [-]
sense
ENSCAFT00000025893 ; HUWE1-202; intron 57
ENSCAFT00000025916 ; HUWE1-201; intron 59
Database links

Mature sequence cfa-miR-98

Accession MIMAT0006756
Sequence

1 - 

ugagguaguaaguuguauuguu

 - 22

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).