Stem-loop sequence ssc-mir-30b

AccessionMI0008215 (change log)
DescriptionSus scrofa miR-30b stem-loop
Gene family MIPF0000005; mir-30
Literature search

20 open access papers mention ssc-mir-30b
(38 sentences)

Stem-loop
   uu      cgu          u  -a        uaaua 
5'   ucaguu   guaaacaucc ac  cucagcug     c
     ||||||   |||||||||| ||  ||||||||      
3'   agucga   cauuuguagg ug  gggucggu     a
   --      cuu          -  ga        uaggu 
Get sequence
Deep sequencing
3375 reads, 500 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr4: 6717643-6717718 [+]
intergenic
chrUScaf3775: 156266-156341 [-]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-30b
ssc-mir-30dchr4: 6713518-6713596 [+]
ssc-mir-30bchr4: 6717643-6717718 [+]
Database links

Mature sequence ssc-miR-30b-5p

Accession MIMAT0007756
Previous IDsssc-miR-30b
Sequence

11 - 

uguaaacauccuacacucagcu

 - 32

Get sequence
Deep sequencing3346 reads, 15 experiments
Evidence experimental; cloned [1,4], 454 [2], Illumina [3,5-6]

Mature sequence ssc-miR-30b-3p

Accession MIMAT0015269
Sequence

49 - 

cugggagguggauguuuacuu

 - 69

Get sequence
Deep sequencing29 reads, 8 experiments
Evidence experimental; Illumina [3,5-6]

References

1
PMID:18548309 "Identification and characterization of new microRNAs from pig" Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS Mamm Genome. 19:570-580(2008).
2
PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
3
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
4
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
5
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
6
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).