Stem-loop sequence ptr-let-7g

AccessionMI0008406 (change log)
DescriptionPan troglodytes let-7g stem-loop
Gene family MIPF0000002; let-7
Literature search

4 open access papers mention ptr-let-7g
(9 sentences)

Stem-loop
   a   u        a            ugagg    -a  a    a 
5'  ggc gagguagu guuuguacaguu     gucu  ug uacc c
    ||| |||||||| ||||||||||||     ||||  || ||||  
3'  ccg uuccguca cggacaugucaa     uaga  ac augg c
   -   -        c            -----    gg  -    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr3: 53382136-53382218 [-]
sense
ENSPTRT00000054348 ; ptr-let-7g-201; exon 1
Database links

Mature sequence ptr-let-7g

Accession MIMAT0007942
Sequence

5 - 

ugagguaguaguuuguacaguu

 - 26

Get sequence
Evidence by similarity; MI0000433
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).