Stem-loop sequence ptr-mir-134

AccessionMI0008535 (change log)
DescriptionPan troglodytes miR-134 stem-loop
Gene family MIPF0000112; mir-134
Stem-loop
   -     gu        u  -a   g    ---    g 
5'  agggu  gugacugg ug  cca aggg   gcau c
    |||||  |||||||| ||  ||| ||||   |||| a
3'  uccca  cacugauc ac  ggu uccc   ugug c
   c     ac        c  cg   g    acu    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr14: 86302921-86302992 [+]
sense
ENSPTRT00000054256 ; ptr-mir-134-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-134
ptr-mir-381chr14: 86294164-86294237 [+]
ptr-mir-487bchr14: 86294699-86294781 [+]
ptr-mir-539chr14: 86295556-86295632 [+]
ptr-mir-889chr14: 86296136-86296213 [+]
ptr-mir-544chr14: 86296887-86296976 [+]
ptr-mir-655chr14: 86297767-86297874 [+]
ptr-mir-487achr14: 86300680-86300758 [+]
ptr-mir-382chr14: 86302540-86302614 [+]
ptr-mir-134chr14: 86302921-86302992 [+]
ptr-mir-668chr14: 86303493-86303557 [+]
ptr-mir-485chr14: 86303654-86303725 [+]
ptr-mir-453chr14: 86304425-86304503 [+]
ptr-mir-154chr14: 86308003-86308086 [+]
ptr-mir-496chr14: 86308822-86308922 [+]
ptr-mir-377chr14: 86310299-86310366 [+]
Database links

Mature sequence ptr-miR-134

Accession MIMAT0008031
Sequence

7 - 

ugugacugguugaccagagggg

 - 28

Get sequence
Evidence by similarity; MI0000474
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).