Stem-loop sequence ptr-mir-302b

AccessionMI0008600 (change log)
DescriptionPan troglodytes miR-302b stem-loop
Gene family MIPF0000071; mir-302
Literature search

1 open access papers mention ptr-mir-302b
(6 sentences)

Stem-loop
   gcucc    a   uu          ug   u  guga 
5'      cuuc acu  aacauggaag  cuu cu    c
        |||| |||  ||||||||||  ||| ||    u
3'      gagg uga  uuguaccuuc  gaa ga    u
   -----    a   uu          gu   u  aaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr4: 115711790-115711861 [-]
sense
ENSPTRT00000054449 ; ptr-mir-302b-201; exon 1
antisense
ENSPTRT00000030467 ; LARP7-201; intron 8
Clustered miRNAs
< 10kb from ptr-mir-302b
ptr-mir-302bchr4: 115711790-115711861 [-]
ptr-mir-302cchr4: 115711658-115711724 [-]
ptr-mir-302achr4: 115711478-115711545 [-]
ptr-mir-302dchr4: 115711299-115711365 [-]
ptr-mir-367chr4: 115711169-115711235 [-]
Database links

Mature sequence ptr-miR-302b

Accession MIMAT0008087
Sequence

47 - 

uaagugcuuccauguuuuaguag

 - 69

Get sequence
Evidence by similarity; MI0000772
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).