Stem-loop sequence ptr-mir-410

AccessionMI0008658 (change log)
DescriptionPan troglodytes miR-410 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   -    c      g    ug      a  a     - uuuu 
5'  guac ugagaa aggu  ucugug ug guucg c    a
    |||| |||||| ||||  |||||| || ||||| |     
3'  caug acuuuu uccg  agacac au uaagc g    u
   c    -      g    gu      a  a     a uaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr14: 86314162-86314240 [+]
sense
ENSPTRT00000054330 ; ptr-mir-410-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-410
ptr-mir-453chr14: 86304425-86304503 [+]
ptr-mir-154chr14: 86308003-86308086 [+]
ptr-mir-496chr14: 86308822-86308922 [+]
ptr-mir-377chr14: 86310299-86310366 [+]
ptr-mir-409chr14: 86313550-86313627 [+]
ptr-mir-412chr14: 86313697-86313786 [+]
ptr-mir-369chr14: 86313848-86313916 [+]
ptr-mir-410chr14: 86314162-86314240 [+]
ptr-mir-656chr14: 86314977-86315053 [+]
Database links

Mature sequence ptr-miR-410

Accession MIMAT0008137
Sequence

49 - 

aauauaacacagauggccugu

 - 69

Get sequence
Evidence by similarity; MI0002465
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).