Stem-loop sequence ptr-mir-521-1

AccessionMI0008731 (change log)
DescriptionPan troglodytes miR-521-1 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   -    g  u     c   c         aa u    guug  u 
5'  cuca gc gugac cuc aaagggaag  c uucu    uc a
    |||| || ||||| ||| |||||||||  | ||||    || a
3'  gagu ug cauug gag uuucccuuc  g aaga    ag a
   a    g  c     u   a         ac c    --aa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 56096062-56096147 [+]
sense
ENSPTRT00000060985 ; ptr-mir-521-1-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-521-1
ptr-mir-518achr19: 56086733-56086818 [+]
ptr-mir-517b-2chr19: 56088737-56088802 [+]
ptr-mir-520hchr19: 56089945-56090033 [+]
ptr-mir-521-1chr19: 56096062-56096147 [+]
ptr-mir-522chr19: 56098628-56098713 [+]
ptr-mir-519fchr19: 56099801-56099908 [+]
ptr-mir-527chr19: 56101441-56101526 [+]
ptr-mir-516a-1chr19: 56104159-56104247 [+]
ptr-mir-1283bchr19: 56105638-56105756 [+]
Database links

Mature sequence ptr-miR-521

Accession MIMAT0008205
Sequence

53 - 

aacgcacuucccuuuagagugu

 - 74

Get sequence
Evidence by similarity; MI0003163
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).