Stem-loop sequence ptr-mir-654

AccessionMI0008841 (change log)
DescriptionPan troglodytes miR-654 stem-loop
Gene family MIPF0000409; mir-654
Literature search

1 open access papers mention ptr-mir-654
(1 sentences)

Stem-loop
   -   aagugg    a      g c     a      - -  a 
5'  ggu      aaag uggugg c gcaga caugug c ug g
    |||      |||| |||||| | ||||| |||||| | ||  
3'  ccg      uuuc acuacc g cgucu guauac g gc u
   c   --aaga    c      a u     -      c u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr14: 86288467-86288546 [+]
sense
ENSPTRT00000054596 ; ptr-mir-654-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-654
ptr-mir-543chr14: 86280507-86280583 [+]
ptr-mir-495chr14: 86282275-86282355 [+]
ptr-mir-376cchr14: 86287939-86288003 [+]
ptr-mir-376a-2chr14: 86288317-86288395 [+]
ptr-mir-654chr14: 86288467-86288546 [+]
ptr-mir-376bchr14: 86288684-86288782 [+]
ptr-mir-376a-1chr14: 86289030-86289096 [+]
ptr-mir-300chr14: 86289611-86289692 [+]
ptr-mir-1185-1chr14: 86291220-86291304 [+]
ptr-mir-1185-2chr14: 86292441-86292525 [+]
ptr-mir-381chr14: 86294164-86294237 [+]
ptr-mir-487bchr14: 86294699-86294781 [+]
ptr-mir-539chr14: 86295556-86295632 [+]
ptr-mir-889chr14: 86296136-86296213 [+]
ptr-mir-544chr14: 86296887-86296976 [+]
ptr-mir-655chr14: 86297767-86297874 [+]
Database links

Mature sequence ptr-miR-654

Accession MIMAT0008304
Sequence

50 - 

uaugucugcugaccaucaccuu

 - 71

Get sequence
Evidence by similarity; MI0003676
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).