Stem-loop sequence dvi-mir-279

AccessionMI0009482 (change log)
DescriptionDrosophila virilis miR-279 stem-loop
Gene family MIPF0000184; mir-279
Literature search

1 open access papers mention dvi-mir-279
(7 sentences)

Stem-loop
   gu         u          a     c  uguu     uucguuuu 
5'   acuacuguu uuagugagug ggguc ag    ucaca        u
     ||||||||| |||||||||| ||||| ||    |||||         
3'   ugauggcaa aauuacucac ccuag uc    agugu        u
   cu         c          a     a  ----     uuaugaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12822: 2330926-2331019 [+]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-279
dvi-mir-279scaffold_12822: 2330926-2331019 [+]
dvi-mir-996scaffold_12822: 2333414-2333511 [+]
Database links

Mature sequence dvi-miR-279-5p

Accession MIMAT0032047
Sequence

15 - 

agugagugaggguccaguguuucaca

 - 40

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-279-3p

Accession MIMAT0008915
Previous IDsdvi-miR-279
Sequence

61 - 

ugacuagauccacacucauuaa

 - 82

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).