Stem-loop sequence dvi-mir-277

AccessionMI0009513 (change log)
DescriptionDrosophila virilis miR-277 stem-loop
Gene family MIPF0000156; mir-277
Literature search

1 open access papers mention dvi-mir-277
(1 sentences)

Stem-loop
   ca       gc  -   gu    -            --  gaaac 
5'   guuuugg  ug cgu  cagg agugcauuugca  cu     a
     |||||||  || |||  |||| ||||||||||||  ||     u
3'   caagacc  ac gca  gucu ucacguaaaugu  ga     u
   ug       uu  a   ug    a            uc  aaguc 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12855: 2684222-2684310 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-277
dvi-mir-9716scaffold_12855: 2693707-2693761 [-]
dvi-mir-277scaffold_12855: 2684222-2684310 [-]
dvi-mir-34scaffold_12855: 2682554-2682640 [-]
Database links

Mature sequence dvi-miR-277-5p

Accession MIMAT0032072
Sequence

14 - 

cgugucaggagugcauuugca

 - 34

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-277-3p

Accession MIMAT0008946
Previous IDsdvi-miR-277
Sequence

56 - 

uaaaugcacuaucugguacgaca

 - 78

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).