Stem-loop sequence mmu-mir-1936

AccessionMI0009925 (change log)
Symbol MGI:Mir1936
DescriptionMus musculus miR-1936 stem-loop
Literature search

3 open access papers mention mmu-mir-1936
(3 sentences)

Stem-loop
   --       g aggg         ca     -   a -u     -cu  g 
5'   agggggu a    gaggccagu  cacag agg c  uuagu   ga a
     ||||||| |    |||||||||  ||||| ||| |  |||||   ||  
3'   uccccca u    cuccgguca  guguc ucc g  aauca   uu a
   ag       g ---a         -a     g   a uc     aag  a 
Get sequence
Deep sequencing
118 reads, 0 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 102684928-102685020 [-]
sense
OTTMUST00000111525 ; Itpk1-001; intron 1
OTTMUST00000111527 ; Itpk1-002; intron 1
OTTMUST00000111528 ; Itpk1-003; intron 1
OTTMUST00000111531 ; RP23-377G8.1-001; intron 2
ENSMUST00000046518 ; Itpk1-001; intron 1
ENSMUST00000179210 ; Itpk1-002; intron 1
ENSMUST00000178697 ; Itpk1-003; intron 1
ENSMUST00000178129 ; Gm21971-001; intron 2
Database links

Mature sequence mmu-miR-1936

Accession MIMAT0009400
Sequence

56 - 

uaacugaccugcugugaacuggc

 - 78

Get sequence
Deep sequencing110 reads, 34 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).