Stem-loop sequence cte-let-7

AccessionMI0010095 (change log)
Previous IDscap-let-7
DescriptionCapitella teleta let-7 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   cccccug   -    u    uu   g   u            aga   acauc 
5'        gcu uacc ccag  gag uag agguuguauagu   guu     a
          ||| |||| ||||  ||| ||| ||||||||||||   |||     c
3'        cga augg gguc  uuc auc uccgacauguca   cag     u
   ---guca   c    -    cu   g   u            -ag   acaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB294122.1: 267294-267396 [+]
intergenic
Clustered miRNAs
< 10kb from cte-let-7
cte-mir-100KB294122.1: 267073-267173 [+]
cte-let-7KB294122.1: 267294-267396 [+]
Database links

Mature sequence cte-let-7

Accession MIMAT0009552
Previous IDscap-let-7
Sequence

21 - 

ugagguaguagguuguauagu

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).