Stem-loop sequence lgi-let-7

AccessionMI0010143 (change log)
DescriptionLottia gigantea let-7 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   aaucu       a     auu   g   u             gagaauua a  ua 
5'      uuuguga uucgg   gag uag agguuguauaguu        c cc  g
        ||||||| |||||   ||| ||| |||||||||||||        | ||   
3'      aaacacu gaguc   uuc auc uccaacaugucaa        g gg  a
   ----c       -     ccu   g   u             -------- c  uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Helro1; GCA_000327385.1) Overlapping transcripts
KB200869.1: 2791958-2792058 [-]
intergenic
Clustered miRNAs
< 10kb from lgi-let-7
lgi-mir-100KB200869.1: 2793558-2793658 [-]
lgi-let-7KB200869.1: 2791958-2792058 [-]
Database links

Mature sequence lgi-let-7

Accession MIMAT0009604
Sequence

21 - 

ugagguaguagguuguauaguu

 - 42

Get sequence
Evidence by similarity; MI0000064

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).