Stem-loop sequence spu-mir-200

AccessionMI0010188 (change log)
DescriptionStrongylocentrotus purpuratus miR-200 stem-loop
Gene family MIPF0000019; mir-8
Literature search

1 open access papers mention spu-mir-200
(1 sentences)

Stem-loop
   -----u    ---       -  ug     c      -cg      
5'       ggug   acaucau ac  gacag auugga   ugauu 
         ||||   ||||||| ||  ||||| ||||||   |||| g
3'       ucac   uguagua ug  cuguc uaaucu   gcuag 
   uuucgg    agu       g  gu     a      cuu      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN920481.1: 158992-159072 [-]
intergenic
Database links

Mature sequence spu-miR-200-5p

Accession MIMAT0013801
Previous IDsspu-miR-200*
Sequence

7 - 

caucauacuggacagcauugga

 - 28

Get sequence
Evidence experimental; 454 [1], Illumina [1]

Mature sequence spu-miR-200-3p

Accession MIMAT0009652
Previous IDsspu-miR-200
Sequence

47 - 

uaauacugucuggugaugauguu

 - 69

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).
2