Stem-loop sequence spu-mir-2009

AccessionMI0010279 (change log)
DescriptionStrongylocentrotus purpuratus miR-2009 stem-loop
Gene family MIPF0001923; mir-2009
Literature search

1 open access papers mention spu-mir-2009
(1 sentences)

Stem-loop
   uucaaa  cu   ua    u  g         a       c  u aa  a 
5'       uc  cag  aucu ug uuuuugugg acagcuc ug g  uu u
         ||  |||  |||| || ||||||||| ||||||| || |  ||  
3'       ag  guc  uaga ac agaaacacc uguugag ac c  aa a
   cuacua  -u   gc    c  a         c       u  - ag  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN914818.1: 42674-42773 [-]
intergenic
Database links

Mature sequence spu-miR-2009

Accession MIMAT0009750
Sequence

61 - 

ugaguugucccacaaagaacaca

 - 83

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).