Stem-loop sequence spu-mir-2011

AccessionMI0010281 (change log)
DescriptionStrongylocentrotus purpuratus miR-2011 stem-loop
Gene family MIPF0000739; mir-2011
Literature search

1 open access papers mention spu-mir-2011
(1 sentences)

Stem-loop
   gcacc  g    g        ca       c        c    --   uu 
5'      gu ccua ucucccug  gucacua cacaccuu ggug  gcu  u
        || |||| ||||||||  ||||||| |||||||| ||||  |||   
3'      ca gggu agggggac  uagugau guguggaa ccac  cga  u
   acuaa  a    -        ag       c        -    uu   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN918731.1: 274801-274900 [+]
intergenic
Database links

Mature sequence spu-miR-2011

Accession MIMAT0009752
Sequence

60 - 

accaaggugugcuagugaugac

 - 81

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).
2