Stem-loop sequence mtr-MIR1510b

AccessionMI0010540 (change log)
DescriptionMedicago truncatula miR1510b stem-loop
Gene family MIPF0000703; MIR1510
Literature search

1 open access papers mention mtr-MIR1510b
(2 sentences)

Stem-loop
      uc   uu      --   -   --   c  -       ------uug   cu    uu           c c      c  c   u    c  u        g    c  c     c      
5' aca  uag  agucau  acc gau  agg ga gagagau         cua  gcaa  guuguuuuacc g uccucc au cca ggau cc accaugug acuc au aucau agauc 
   |||  |||  ||||||  ||| |||  ||| || |||||||         |||  ||||  ||||||||||| | |||||| || ||| |||| || |||||||| |||| || ||||| |||| c
3' ugu  guc  uuagua  ugg cua  ucc cu cucuuua         gau  cguu  caacaaaaugg c aggagg ua ggu ccua gg ugguacac ugag ua uagug ucuaa 
      cu   -u      uu   a   cu   a  a       cuuaguaaa   uu    uu           a u      -  a   c    u  c        -    a  a     u      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 18612353-18612588 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR1510b
mtr-MIR1510bchr5: 18612353-18612588 [+]
mtr-MIR1510achr5: 18616293-18616456 [+]
mtr-MIR2592jchr5: 18620902-18621150 [+]
Database links

Mature sequence mtr-miR1510b-5p

Accession MIMAT0010028
Previous IDsmtr-miR1510b*
Sequence

74 - 

ccauggaucccuaccaugugg

 - 94

Get sequence
Evidence experimental; Illumina [1-2], Northern [1]

Mature sequence mtr-miR1510b-3p

Accession MIMAT0010029
Previous IDsmtr-miR1510b
Sequence

135 - 

acauggucgguaucccuggaa

 - 155

Get sequence
Evidence experimental; Illumina [1-2], Northern [1]

References

1
PMID:19068109 "High-throughput sequencing of Medicago truncatula short RNAs identifies eight new miRNA families" Szittya G, Moxon S, Santos DM, Jing R, Fevereiro MP, Moulton V, Dalmay T BMC Genomics. 9:593(2008).
2
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).