Stem-loop sequence mtr-MIR1507

AccessionMI0010541 (change log)
DescriptionMedicago truncatula miR1507 stem-loop
Gene family MIPF0000699; MIR1507
Literature search

4 open access papers mention mtr-MIR1507
(13 sentences)

Stem-loop
       uaa  uccaa      ug      ag    -gu            aa  u     uuucuu       uc 
5' acca   ac     uuaaug  guguug  uaga   uguauggaacga  ga gggaa      guugaau  u
   ||||   ||     ||||||  ||||||  ||||   ||||||||||||  || |||||      |||||||  a
3' uggu   ug     aauugu  cauaac  aucu   acauaccuugcu  cu cccuu      uaacuua  u
       uuc  uuaac      gu      cg    acu            cc  -     -----u       cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 46264970-46265113 [+]
intergenic
Database links

Mature sequence mtr-miR1507-5p

Accession MIMAT0010030
Previous IDsmtr-miR1507*
Sequence

32 - 

agaguuguauggaacgaaagau

 - 53

Get sequence
Evidence experimental; Illumina [1], Northern [1]

Mature sequence mtr-miR1507-3p

Accession MIMAT0010031
Previous IDsmtr-miR1507
Sequence

94 - 

ccucguuccauacaucaucuag

 - 115

Get sequence
Evidence experimental; Illumina [1], Northern [1-2], 454 [2]

References

1
PMID:19068109 "High-throughput sequencing of Medicago truncatula short RNAs identifies eight new miRNA families" Szittya G, Moxon S, Santos DM, Jing R, Fevereiro MP, Moulton V, Dalmay T BMC Genomics. 9:593(2008).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).