Stem-loop sequence mtr-MIR1509a

AccessionMI0010543 (change log)
Previous IDsmtr-MIR1509
DescriptionMedicago truncatula miR1509 stem-loop
Gene family MIPF0000771; MIR1509
Literature search

2 open access papers mention mtr-MIR1509a
(4 sentences)

Stem-loop
        -   cu --ucuu         cu    a    uuu     cu   -uc  ----guuuucuuu   u   u c             u      aua            uuuuucuuuuuauugu 
5' cccgg ccu  c      gccucauag  aguu gggu   cguug  guc   gu             uga cca u aauuuuuuuaauc aggaaa   cgguggagaggg                u
   ||||| |||  |      |||||||||  |||| ||||   |||||  |||   ||             ||| ||| | ||||||||||||| ||||||   ||||||||||||                u
3' ggguc gga  g      cggaguauu  ucga ccua   guaac  uag   cg             acu ggu a uuaaagaaauuag uccuuu   gccaucucuucu                g
        u   au uuuuuc         ac    c    ugu     ag   uau  auuuuuuauuauu   u   c u             u      -ag            gcucucuauaguuaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 36253579-36253832 [+]
intergenic
Database links

Mature sequence mtr-miR1509a-5p

Accession MIMAT0010034
Previous IDsmtr-miR1509
Sequence

79 - 

uuaaucuaggaaaauacggug

 - 99

Get sequence
Evidence experimental; Illumina [1-2], Northern [1]

Mature sequence mtr-miR1509a-3p

Accession MIMAT0010035
Previous IDsmtr-miR1509*
Sequence

150 - 

accggauuuccuugauuaaag

 - 170

Get sequence
Evidence experimental; Illumina [1], Northern [1]

References

1
PMID:19068109 "High-throughput sequencing of Medicago truncatula short RNAs identifies eight new miRNA families" Szittya G, Moxon S, Santos DM, Jing R, Fevereiro MP, Moulton V, Dalmay T BMC Genomics. 9:593(2008).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).