Stem-loop sequence gma-MIR2107

AccessionMI0010576 (change log)
DescriptionGlycine max miR2107 stem-loop
Stem-loop
   -aucca     cc    -cc  u   a 
5'       aaccu  guag   ug auc a
         |||||  ||||   || |||  
3'       uugga  cauc   ac uag a
   cuacac     cu    cuc  c   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 10318510-10318563 [-]
intergenic
chr2: 32510679-32510732 [+]
intergenic
chr3: 41309189-41309242 [+]
intergenic
chr5: 16223238-16223291 [-]
intergenic
chr5: 25747306-25747359 [-]
intergenic
chr6: 1061619-1061672 [+]
intergenic
chr6: 31956877-31956930 [-]
intergenic
chr7: 19981335-19981388 [-]
intergenic
chr8: 18988324-18988377 [+]
intergenic
chr8: 29256415-29256468 [+]
intergenic
chr8: 29312563-29312616 [+]
intergenic
chr8: 29632575-29632628 [+]
intergenic
chr9: 23972088-23972141 [-]
intergenic
chr9: 23978269-23978322 [-]
intergenic
chr10: 21931850-21931903 [-]
intergenic
chr11: 18072585-18072638 [-]
intergenic
chr12: 22864546-22864599 [-]
intergenic
chr13: 4200516-4200569 [-]
intergenic
chr13: 4391463-4391516 [+]
intergenic
chr13: 6257910-6257963 [-]
intergenic
chr13: 6275914-6275967 [-]
intergenic
chr13: 6503315-6503368 [-]
intergenic
chr13: 19620870-19620923 [-]
intergenic
chr14: 15143588-15143641 [+]
intergenic
chr14: 15145918-15145971 [+]
intergenic
chr14: 32591476-32591529 [-]
intergenic
chr14: 36566434-36566487 [-]
intergenic
chr14: 39116317-39116370 [-]
intergenic
chr14: 42975048-42975101 [+]
intergenic
chr15: 38800335-38800388 [+]
intergenic
chr15: 39127500-39127553 [-]
intergenic
chr15: 39239422-39239475 [+]
intergenic
chr15: 39345386-39345439 [-]
intergenic
chr15: 39416674-39416727 [-]
intergenic
chr15: 39427871-39427924 [+]
intergenic
chr16: 10157565-10157618 [-]
intergenic
chr16: 17632349-17632402 [+]
intergenic
chr16: 17645625-17645678 [+]
intergenic
chr16: 18406771-18406824 [-]
intergenic
chr17: 25935203-25935256 [+]
intergenic
chr17: 25944777-25944830 [-]
intergenic
chr18: 32133824-32133877 [+]
intergenic
chr18: 32231558-32231611 [-]
intergenic
chr19: 2808683-2808736 [-]
intergenic
chr19: 23512104-23512157 [-]
intergenic
KQ474122.1: 691596-691649 [-]
intergenic
KQ474129.1: 293419-293472 [-]
intergenic
KQ474129.1: 295674-295727 [-]
intergenic
KQ474130.1: 259800-259853 [+]
intergenic
KQ474131.1: 50700-50753 [-]
intergenic
KQ474134.1: 119737-119790 [+]
intergenic
KQ474134.1: 121917-121970 [+]
intergenic
KQ474144.1: 7123-7176 [+]
intergenic
KQ474144.1: 195624-195677 [+]
intergenic
KQ474148.1: 139084-139137 [+]
intergenic
KQ474149.1: 94706-94759 [+]
intergenic
KQ474151.1: 96199-96252 [-]
intergenic
KQ474206.1: 1832-1885 [-]
intergenic
KQ474206.1: 26983-27036 [+]
intergenic
Database links

Mature sequence gma-miR2107

Accession MIMAT0010083
Sequence

4 - 

caaaccuccguagccuguauc

 - 24

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).