Stem-loop sequence ssc-mir-124a-1

AccessionMI0010680 (change log)
DescriptionSus scrofa miR-124a-1 stem-loop
Gene family MIPF0000021; mir-124
Literature search

15 open access papers mention ssc-mir-124a-1
(80 sentences)

Stem-loop
        ac   ------a      c  cc        a   ga        uaau 
5' ucaag  cag       cucugc cu  guguucac gcg  ccuugauu    g
   |||||  |||       |||||| ||  |||||||| |||  ||||||||    u
3' aguuc  guc       gaggcg ga  cguaagug cgc  ggaauuaa    c
        ac   ggcaucc      a  ac        g   ac        caua 
Get sequence
Deep sequencing
13 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr4: 76136453-76136557 [-]
intergenic
chrUScaf3700: 125788-125892 [-]
intergenic
Database links

Mature sequence ssc-miR-124a

Accession MIMAT0002156
Sequence

59 - 

uaaggcacgcggugaaugcca

 - 79

Get sequence
Deep sequencing26 reads, 6 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).