Stem-loop sequence ssc-mir-503

AccessionMI0010684 (change log)
DescriptionSus scrofa miR-503 stem-loop
Gene family MIPF0000183; mir-503
Literature search

2 open access papers mention ssc-mir-503
(3 sentences)

Stem-loop
         - -----a       g     ua                 g   u gg g 
5' gccccg c      cucagcc ugccc  gcagcgggaacaguacu cag g  c a
   |||||| |      ||||||| |||||  ||||||||||||||||| ||| |  | u
3' cggggc g      gggucgg acggg  cgucgucuuuguuaugg guc c  g c
         c cccuca       a     cc                 g   u au g 
Get sequence
Deep sequencing
2427 reads, 253 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-503

Accession MIMAT0010189
Sequence

22 - 

uagcagcgggaacaguacugcag

 - 44

Get sequence
Deep sequencing2410 reads, 15 experiments
Evidence experimental; 454 [1], Illumina [2-3]

References

1
PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).