Stem-loop sequence hsv2-mir-H2

AccessionMI0010694 (change log)
DescriptionHerpes Simplex Virus 2 miR-H2 stem-loop
Stem-loop 
   u         c  -   -   c      cu ug u 
5'  cggucgcgc ug ccc ggc cagacu  g  c u
    ||||||||| || ||| ||| ||||||  |  |  
3'  gccagcgcg ac ggg ccg gucugg  u  g g
   g         u  u   u   a      -c gu g
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was named miR-III in [1], but is a clear homolog of miR-H2 in HSV-1.

Database links

Mature sequence hsv2-miR-H2

Accession MIMAT0010205
Sequence

44 -  

ucugagccugggucaugcgcga

 - 65

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:19019961 "Novel less-abundant viral microRNAs encoded by herpes simplex virus 2 latency-associated transcript and their roles in regulating ICP34.5 and ICP0 mRNAs" Tang S, Patel A, Krause PR J Virol. 83:1433-1442(2009).
2
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).