Stem-loop sequence sme-mir-2159

AccessionMI0010792 (change log)
DescriptionSchmidtea mediterranea miR-2159 stem-loop
Stem-loop
   -a   -ca         a   cu       c    a     ug     ag 
5'   aug   aaugaauuc aaa  gccuuuu uuug guagc  uccgc  a
     |||   ||||||||| |||  ||||||| |||| |||||  |||||   
3'   ugc   uuacuuaag uuu  ugggaaa aaac cgucg  aggug  c
   aa   uac         g   ag       u    -     --     ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig9447: 14574-14670 [+]
intergenic
Database links

Mature sequence sme-miR-2159-5p

Accession MIMAT0011252
Sequence

21 - 

ugccuuuucuuugaguagc

 - 39

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-2159-3p

Accession MIMAT0012150
Sequence

55 - 

ggagcugccaaauaaagggugau

 - 77

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).