Stem-loop sequence sme-mir-2173

AccessionMI0010818 (change log)
DescriptionSchmidtea mediterranea miR-2173 stem-loop
Stem-loop
   ---acaauucua    u       aa          a     ac     gaaag 
5'             guaa caaugga  caacuuguau ugcau  guaua     a
               |||| |||||||  |||||||||| |||||  |||||      
3'             uauu guuacuu  guugaauaua augua  cauau     a
   agccuacuaaaa    -       aa          c     --     aacaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig11322: 1540-1643 [-]
intergenic
Contig5049: 3185-3288 [+]
intergenic
Database links

Mature sequence sme-miR-2173-5p

Accession MIMAT0012164
Previous IDssme-miR-2173*
Sequence

22 - 

aacaacuuguauaugcauacgua

 - 44

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-2173-3p

Accession MIMAT0011274
Previous IDssme-miR-2173
Sequence

61 - 

uacauguacauauaaguugaauuc

 - 84

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).