Stem-loop sequence sme-mir-753d

AccessionMI0010940 (change log)
DescriptionSchmidtea mediterranea miR-753d stem-loop
Gene family MIPF0000752; mir-753
Stem-loop
   ----uc           u           u 
5'       agggcuuggau gugaucucgua a
         ||||||||||| |||||||||||  
3'       ucucgaacuua uacuagaguau u
   uaaauc           u           u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was named mir-753b-2 in [1]. The mature sequence differs from mir-753b, so the entry is renamed here.

Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig12996: 14529-14586 [-]
intergenic
Database links

Mature sequence sme-miR-753d-5p

Accession MIMAT0011404
Sequence

2 - 

cagggcuuggauugugaucuc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sme-miR-753d-3p

Accession MIMAT0011405
Sequence

34 - 

agaucauuauucaagcucucu

 - 54

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).