Stem-loop sequence sme-mir-2147d

AccessionMI0010941 (change log)
DescriptionSchmidtea mediterranea miR-2147d stem-loop
Gene family MIPF0000751; mir-2147
Stem-loop
   u    ----u     u  u     c    aac     cc    u     ca 
5'  ugcu     uugga gu aacau ggaa   ucgca  guga auugu  a
    ||||     ||||| || ||||| ||||   |||||  |||| |||||  c
3'  acgg     gaccu ca uugua ccuu   agcgu  cacu uaaca  u
   -    cuuuu     u  -     c    guc     --    u     cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig3339: 35249-35345 [+]
intergenic
Database links

Mature sequence sme-miR-2147d-5p

Accession MIMAT0011406
Sequence

21 - 

cggaaaacucgcaccgugauau

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sme-miR-2147d-3p

Accession MIMAT0011407
Sequence

57 - 

uuucacugcgacuguucccau

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).