Stem-loop sequence sme-mir-2205

AccessionMI0010942 (change log)
DescriptionSchmidtea mediterranea miR-2205 stem-loop
Stem-loop
   -ccuc ua      uu   ua     u  a    --    a  u 
5'      u  guugug  gga  gugag aa gcgg  ugau gu u
        |  ||||||  |||  ||||| || ||||  |||| ||  
3'      a  uagcac  ccu  uacuc uu uguc  acua ca c
   uaauu gc      --   uc     u  a    ua    -  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig5365: 28923-29006 [-]
intergenic
Database links

Mature sequence sme-miR-2205-5p

Accession MIMAT0011408
Previous IDssme-miR-2205
Sequence

15 - 

uggauagugaguaaagcgguga

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sme-miR-2205-3p

Accession MIMAT0011409
Previous IDssme-miR-2205*
Sequence

52 - 

ucuguauuucucaucuuccca

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).