Stem-loop sequence sme-mir-754c-2

AccessionMI0010946 (change log)
DescriptionSchmidtea mediterranea miR-754c-2 stem-loop
Gene family MIPF0000749; mir-754
Stem-loop
   -a      - a c       u   -    uu        u 
5'   uccacc c g auguugc ugg ggua  acuauauu a
     |||||| | | ||||||| ||| ||||  ||||||||  
3'   aggugg g c uauaacg acu cuau  ugauauaa u
   ua      a a -       u   u    uu        u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig5823: 26722-26799 [+]
intergenic
Database links

Mature sequence sme-miR-754c-5p

Accession MIMAT0011237
Previous IDssme-miR-754c
Sequence

14 - 

guugcuugggguauuacuau

 - 33

Get sequence
Evidence experimental; Illumina [1-2], 454 [2]

Mature sequence sme-miR-754c-2-3p

Accession MIMAT0013775
Previous IDssme-miR-754c-2*
Sequence

45 - 

uaguuuuaucuucaugcaauauca

 - 68

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).