Stem-loop sequence sme-mir-2202

AccessionMI0010949 (change log)
DescriptionSchmidtea mediterranea miR-2202 stem-loop
Stem-loop
   ua      au      u   c    a   u         cuu  uua 
5'   aguugg  uugaua gcg aaaa gaa auuaaucga   ug   a
     ||||||  |||||| ||| |||| ||| |||||||||   ||    
3'   ucaacu  aauuau cgc uuuu cuu uaauuagcu   ac   u
   --      --      u   a    c   -         --c  uug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig28205: 2579-2667 [-]
intergenic
Contig4044: 8966-9054 [+]
intergenic
Database links

Mature sequence sme-miR-2202-5p

Accession MIMAT0011417
Previous IDssme-miR-2202
Sequence

17 - 

ugcgcaaaaagaauauuaaucga

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sme-miR-2202-3p

Accession MIMAT0011418
Previous IDssme-miR-2202*
Sequence

58 - 

gauuaauuuccuuuuacgcuua

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).