Stem-loop sequence crm-let-7

AccessionMI0011037 (change log)
DescriptionCaenorhabditis remanei let-7 stem-loop
Gene family MIPF0000002; let-7
Literature search

3 open access papers mention crm-let-7
(9 sentences)

Stem-loop
        c  -ucaaca    gc              u  g            ga ucu 
5' gcggc gg       cugu  gucuggugagguag ag uuguauaguuua  a   u
   ||||| ||       ||||  |||||||||||||| || ||||||||||||  |    
3' cgucg cu       gaca  uagaccacuccauc uu aacguaucaagu  u   a
        a  cuucuaa    --              u  g            gg ucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WS200) Overlapping transcripts
Crem_Contig27: 289521-289633 [-]
intergenic
Database links

Mature sequence crm-let-7

Accession MIMAT0011519
Sequence

27 - 

ugagguaguagguuguauaguu

 - 48

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).