Stem-loop sequence ppc-mir-2267

AccessionMI0011207 (change log)
DescriptionPristionchus pacificus miR-2267 stem-loop
Stem-loop
   auc   -   - c         g    c     u   - c c    a       --g     
5'    cuc cuc c uuuccucgg ccgu uaggg acg c c cgca gcuuagc   cauu 
      ||| ||| | ||||||||| |||| ||||| ||| | | |||| |||||||   ||| g
3'    gag gag g agaggaguc ggua gucuc ugc g g gcgu cgaaucg   guaa 
   -ua   a   a c         -    a     u   u c a    -       gaa     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000073.1: 220769-220883 [+]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-2267
ppc-mir-2272ABKE03000073.1: 220023-220140 [+]
ppc-mir-8263ABKE03000073.1: 220213-220275 [+]
ppc-mir-2273ABKE03000073.1: 220330-220428 [+]
ppc-mir-8223ABKE03000073.1: 220630-220686 [+]
ppc-mir-2267ABKE03000073.1: 220769-220883 [+]
ppc-mir-8351ABKE03000073.1: 225677-225741 [+]
ppc-mir-8299ABKE03000073.1: 226063-226119 [+]
ppc-mir-8348ABKE03000073.1: 226430-226488 [+]
ppc-mir-8282bABKE03000073.1: 226545-226603 [+]
ppc-mir-8282aABKE03000073.1: 226753-226811 [+]
ppc-mir-8282cABKE03000073.1: 227223-227281 [+]
ppc-mir-8358ABKE03000073.1: 227347-227413 [+]
ppc-mir-8320ABKE03000073.1: 227746-227804 [+]
Database links

Mature sequence ppc-miR-2267

Accession MIMAT0011704
Sequence

27 - 

uaggguacgcccccgcaagcuu

 - 48

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).