Stem-loop sequence dps-mir-2567b

AccessionMI0011715 (change log)
DescriptionDrosophila pseudoobscura miR-2567b stem-loop
Gene family MIPF0000934; mir-2567
Stem-loop
   -      -  -uuu  a          u   c  a   uugaa 
5'  uuuuca gu    uu ccagguuaga uug ga acg     u
    |||||| ||    || |||||||||| ||| || |||      
3'  aagagu cg    aa gguccaaucu gac cu ugc     u
   a      u  uuuu  c          c   a  c   ucgau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
4_group4: 3554452-3554536 [+]
intergenic
Clustered miRNAs
< 10kb from dps-mir-2567b
dps-mir-25104_group4: 3551345-3551451 [+]
dps-mir-2566a-14_group4: 3552319-3552402 [+]
dps-mir-2511-14_group4: 3552536-3552652 [+]
dps-mir-2567a4_group4: 3552872-3552956 [+]
dps-mir-2566a-24_group4: 3553033-3553118 [+]
dps-mir-2567c4_group4: 3553417-3553521 [+]
dps-mir-2566b4_group4: 3553900-3553982 [+]
dps-mir-2511-24_group4: 3554138-3554224 [+]
dps-mir-2567b4_group4: 3554452-3554536 [+]
Database links

Mature sequence dps-miR-2567b-5p

Accession MIMAT0012402
Previous IDsdps-miR-2567b*
Sequence

14 - 

accagguuagauuugcgaaacg

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-2567b-3p

Accession MIMAT0012403
Previous IDsdps-miR-2567b
Sequence

50 - 

ucucacagcucuaaccuggcaa

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).