Stem-loop sequence dsi-mir-992

AccessionMI0011764 (change log)
DescriptionDrosophila simulans miR-992 stem-loop
Gene family MIPF0000914; mir-992
Stem-loop
   a      c   u  c              u   auuuuu 
5'  uuuucg aag gc ugguuucagagagg gua      g
    |||||| ||| || |||||||||||||| |||      u
3'  aagagu uuc cg accaagguuuuuuc cau      u
   a      -   c  a              c   gauaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr2R: 15134519-15134598 [-]
intergenic
Clustered miRNAs
< 10kb from dsi-mir-992
dsi-mir-992chr2R: 15134519-15134598 [-]
dsi-mir-991chr2R: 15134391-15134508 [-]
dsi-mir-2498cchr2R: 15134038-15134093 [-]
dsi-mir-2498achr2R: 15133881-15133941 [-]
dsi-mir-2498bchr2R: 15133515-15133573 [-]
dsi-mir-313chr2R: 15132988-15133053 [-]
dsi-mir-312chr2R: 15132849-15132914 [-]
dsi-mir-311chr2R: 15132682-15132767 [-]
dsi-mir-310chr2R: 15132557-15132645 [-]
Database links

Mature sequence dsi-miR-992-5p

Accession MIMAT0012491
Previous IDsdsi-miR-992*
Sequence

13 - 

gccugguuucagagaggugua

 - 33

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence dsi-miR-992-3p

Accession MIMAT0012492
Previous IDsdsi-miR-992
Sequence

51 - 

cccuuuuuuggaaccaagcccu

 - 72

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).
2
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).