Stem-loop sequence mtr-MIR2587c

AccessionMI0011801 (change log)
DescriptionMedicago truncatula miR2587c stem-loop
Gene family MIPF0000835; MIR2587
Stem-loop
   -cgaug      -u    a            c          ug  --------au     
5'       guguca  gguc uuguugaccguu auaugaaccc  ca          ugca 
         ||||||  |||| |||||||||||| ||||||||||  ||          ||| a
3'       uacagu  ccag gauaacuggcaa uauacuuggg  gu          acgu 
   agaaaa      uc    a            -          gu  guucaauuuu     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 26671125-26671234 [+]
intergenic
Database links

Mature sequence mtr-miR2587c

Accession MIMAT0013254
Sequence

21 - 

uugaccguucauaugaacccug

 - 42

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).