Stem-loop sequence mtr-MIR2597

AccessionMI0011834 (change log)
DescriptionMedicago truncatula miR2597 stem-loop
Literature search

1 open access papers mention mtr-MIR2597
(1 sentences)

Stem-loop
   u     --a     c      -u                    gaua      a 
5'  ugaag   cgaau uugauc  aucgacgaaguaucaaauga    gaaauc u
    |||||   ||||| ||||||  ||||||||||||||||||||    |||||| u
3'  acuuu   gcuua aauuag  uagcugcuucaugguuuauu    uuuuag u
   u     aua     a      uu                    -aua      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 18776013-18776119 [-]
intergenic
Database links

Mature sequence mtr-miR2597

Accession MIMAT0013287
Sequence

68 - 

uuugguacuucgucgauuuga

 - 88

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).