Stem-loop sequence mtr-MIR2111m

AccessionMI0011844 (change log)
DescriptionMedicago truncatula miR2111m stem-loop
Gene family MIPF0000754; MIR2111
Literature search

2 open access papers mention mtr-MIR2111m
(8 sentences)

Stem-loop
   --uua      --      u           c         u     -      u 
5'      auuggu  uaagga aggguaaucug auccugagg uuaga gcaaca u
        ||||||  |||||| ||||||||||| ||||||||| ||||| ||||||  
3'      uaacca  auucuu uuucauuagac uagggcucc gaucu uguugu u
   aagug      ua      u           a         u     a      g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 16637685-16637791 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2111m
mtr-MIR2111kchr7: 16644233-16644366 [-]
mtr-MIR2111lchr7: 16644069-16644155 [-]
mtr-MIR2111mchr7: 16637685-16637791 [-]
mtr-MIR2111nchr7: 16637529-16637662 [-]
Database links

Mature sequence mtr-miR2111m-5p

Accession MIMAT0013297
Sequence

21 - 

uaaucugcauccugagguuua

 - 41

Get sequence
Evidence experimental; 454 [1], Illumina [2]

Mature sequence mtr-miR2111m-3p

Accession MIMAT0026928
Sequence

65 - 

guccucgggauacagauuacu

 - 85

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).
2
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).