miRBase entry: mtr-MIR169j

Stem-loop mtr-MIR169j


Accession
MI0011868
Description
Medicago truncatula mtr-MIR169j precursor miRNA
Gene family
MIPF0001058; MIR169_6

Literature search
12 open access papers mention mtr-MIR169j
(56 sentences)

Sequence

agagguagagagaguauauuUGAGCCAGGAUGACUUGCCGGcauuugcuguaaauguagaagaaucccuucucacaauuaagguguuguuggcgaggaaucuaggcucauauuugcucucuuuccacuca
.((((.((((((((((.((.((((((.((((..((((((((((..((((.(((.((((((((.....))))).))).))).)))).))))))))))..)))).)))))).)).)))))))))).).))).

Structure
a   - u          u  u      A    GA          uu    g   a   -     a 
 gag g agagagagua au UGAGCC GGAU  CUUGCCGGca  ugcu uaa ugu agaag a
 ||| | |||||||||| || |||||| ||||  ||||||||||  |||| ||| ||| ||||| u
 cuc c uuucucucgu ua acucgg ucua  gagcgguugu  gugg auu aca ucuuc c
a   a c          u  u      a    ag          -u    a   a   c     c 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr2: 13454079-13454208 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from mtr-MIR169j
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mtr-miR169j

Accession MIMAT0013321
Description Medicago truncatula mtr-miR169j mature miRNA
Sequence 21 - UGAGCCAGGAUGACUUGCCGG - 41
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 19767456
    Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules
    "Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M"
    "Plant Cell (2009) 21:2780-2796

  2. PubMed ID: 22156213
    MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
    "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
    "Genes Dev (2011) 25:2540-2553