Stem-loop sequence mtr-MIR169j

AccessionMI0011868 (change log)
DescriptionMedicago truncatula miR169j stem-loop
Gene family MIPF0001058; MIR169_6
Literature search

12 open access papers mention mtr-MIR169j
(56 sentences)

Stem-loop
   a   - u          u  u      a    ga          uu    g   a   -     a 
5'  gag g agagagagua au ugagcc ggau  cuugccggca  ugcu uaa ugu agaag a
    ||| | |||||||||| || |||||| ||||  ||||||||||  |||| ||| ||| ||||| u
3'  cuc c uuucucucgu ua acucgg ucua  gagcgguugu  gugg auu aca ucuuc c
   a   a c          u  u      a    ag          -u    a   a   c     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 13454079-13454208 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR169j
mtr-MIR5281dchr2: 13445238-13445410 [-]
mtr-MIR169cchr2: 13450873-13450957 [+]
mtr-MIR169jchr2: 13454079-13454208 [+]
Database links

Mature sequence mtr-miR169j

Accession MIMAT0013321
Sequence

21 - 

ugagccaggaugacuugccgg

 - 41

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).