Stem-loop sequence mtr-MIR2630s

AccessionMI0011938 (change log)
DescriptionMedicago truncatula miR2630s stem-loop
Gene family MIPF0000814; MIR2630
Literature search

2 open access papers mention mtr-MIR2630s
(2 sentences)

Stem-loop
   -                u   u                a          a            cau        aaaa       cua      ----------uc          -  a 
5'  cccugcaaauauagaa auu gguuuugguccuuggu uuuuguuuua uccuuguaaaau   uucauauu    uuggucc   uaauau            auuuuaguuc uc u
    |||||||||||||||| ||| |||||||||||||||| |||||||||| ||||||||||||   ||||||||    |||||||   ||||||            |||||||||| || u
3'  gggacguuuauauuuu uaa ccaaaaccaggaacca aaaacaaaau aggaacauuuua   aaguauaa    aaccagg   auuaua            uaaaaucagg ag u
   a                u   c                c          c            acu        gcua       aac      caucuuauaaau          g  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 31925699-31925927 [+]
intergenic
Database links

Mature sequence mtr-miR2630s

Accession MIMAT0013391
Sequence

21 - 

ugguuuugguccuugguauuu

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).