Stem-loop sequence mtr-MIR2654

AccessionMI0011986 (change log)
DescriptionMedicago truncatula miR2654 stem-loop
Stem-loop
   uu  u    a   ga       ag ga ---aaag  ug  uu   -     uug g 
5'   ga ugag uau  caaauuc  g  c       ug  cg  ucg auaaa   g g
     || |||| |||  |||||||  |  |       ||  ||  ||| |||||   |  
3'   cu acuu aua  guuuaag  c  g       ac  gc  agc uguuu   c g
   au  c    -   -g       -- ag gacuuaa  gu  uu   c     uua a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 31151589-31151696 [+]
intergenic
Database links

Mature sequence mtr-miR2654

Accession MIMAT0013439
Sequence

19 - 

auucagggacaaagugugcg

 - 38

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).