Stem-loop sequence mtr-MIR2676a

AccessionMI0012045 (change log)
DescriptionMedicago truncatula miR2676a stem-loop
Gene family MIPF0000831; MIR2676
Stem-loop
   -         gag       -    ug   g  u   aa  ug  ga   u  a   ug      a     ---         -u    aag       -uagagaau       g    cu 
5'  aaauacuuu   augaauu ccau  uuu ga aau  uu  aa  auu uc aaa  auggaa uuuau   gaaguauuu  guuc   uuaaaau         uucaaau acac  a
    |||||||||   ||||||| ||||  ||| || |||  ||  ||  ||| || |||  |||||| |||||   |||||||||  ||||   |||||||         ||||||| ||||   
3'  uuuaugaag   uauuuaa ggua  aaa cu uua  aa  uu  uaa ag uuu  uaccuu aagua   uuucauaaa  uaag   aguuuug         agguuug ugug  a
   u         ---       a    gu   a  u   ag  gu  aa   u  g   gu      -     gaa         cu    -gg       uaaguaagu       -    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 25975055-25975287 [-]
intergenic
Database links

Mature sequence mtr-miR2676a

Accession MIMAT0013498
Sequence

175 - 

cauuguuuggauaauaauuug

 - 195

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).