Stem-loop sequence isc-let-7

AccessionMI0012260 (change log)
DescriptionIxodes scapularis let-7 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention isc-let-7
(12 sentences)

Stem-loop
   gucucugugu u        u   g                  agaa  aca   g 
5'           g accugaag gag uaguagguuguauaguug    cu   ucu c
             | |||||||| ||| ||||||||||||||||||    ||   ||| c
3'           c ugggcuuc uuc aucguucaacaugucaau    ga   agg a
   ---------g -        u   a                  ---c  --g   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence isc-let-7

Accession MIMAT0012680
Sequence

21 - 

ugagguaguagguuguauagu

 - 41

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).