Stem-loop sequence eca-mir-99a-2

AccessionMI0012929 (change log)
DescriptionEquus caballus miR-99a-2 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   cc          a         uc   u       u aag 
5'   cauuggcaua acccguaga  cga cuugugg g   u
     |||||||||| |||||||||  ||| ||||||| |    
3'   gugacugugu uggguaucu  gcu gaacacu c   g
   gu          c         uc   c       - cag 
Get sequence
Deep sequencing
41848 reads, 2.8e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr26: 15508980-15509060 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-99a-2
eca-mir-99a-2chr26: 15508980-15509060 [+]
eca-let-7cchr26: 15509722-15509792 [+]
Database links

Mature sequence eca-miR-99a

Accession MIMAT0013184
Sequence

13 - 

aacccguagauccgaucuugug

 - 34

Get sequence
Deep sequencing41416 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).