Stem-loop sequence ssc-mir-504

AccessionMI0013143 (change log)
DescriptionSus scrofa miR-504 stem-loop
Gene family MIPF0000437; mir-504
Literature search

1 open access papers mention ssc-mir-504
(2 sentences)

Stem-loop
   ----g    -            g     a    -a  u   u 
5'      cugu ugggagacccug ucugc cucu  uc gua g
        |||| |||||||||||| ||||| ||||  || |||  
3'      gaca acccuuugggac ggacg gagg  ag cau c
   cggga    c            g     c    ga  u   u 
Get sequence
Deep sequencing
534 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrX: 129654206-129654285 [+]
sense
ENSSSCT00000029012 ; FGF13-201; intron 3
Database links

Mature sequence ssc-miR-504

Accession MIMAT0013931
Sequence

10 - 

agacccuggucugcacucuaucu

 - 32

Get sequence
Deep sequencing532 reads, 15 experiments
Evidence experimental; Illumina [1-3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).