Stem-loop sequence ctr-MIR156

AccessionMI0013293 (change log)
DescriptionCitrus trifoliata miR156 stem-loop
Gene family MIPF0000008; MIR156
Literature search

5 open access papers mention ctr-MIR156
(41 sentences)

Stem-loop
   -------------------------------------------ugaagaggaagaggaaacauaacgagagagcua            -         a   ag    uu     a 
5'                                                                             cugacagaagag agugagcac cgc  guaa  guauu g
                                                                               |||||||||||| ||||||||| |||  ||||  |||||  
3'                                                                             gacugucuucuc ucgcucgug gug  cguu  uauaa a
   acuaucuuccuucucguuuucucccgacccccaaugcugcacgaccccaacacuccuucgugaacguuuuuacugc            c         c   ga    uc     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ctr-miR156

Accession MIMAT0014067
Sequence

35 - 

ugacagaagagagugagcac

 - 54

Get sequence
Evidence not experimental

References

1
PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).