Stem-loop sequence api-mir-276

AccessionMI0013359 (change log)
DescriptionAcyrthosiphon pisum miR-276 stem-loop
Gene family MIPF0000124; mir-276
Literature search

3 open access papers mention api-mir-276
(5 sentences)

Stem-loop 
   ga   cu    a     ag          uuca   ua 
5'   cca  agcg gguau  aguuccuacg    aau  u
     |||  |||| |||||  ||||||||||    |||  u
3'   ggu  ucgu ccaua  ucaaggaugc    uug  a
   -a   uc    g     cu          -uca   ua
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350277.1: 351893-351969 [+]
intergenic
Database links

Mature sequence api-miR-276

Accession MIMAT0014133
Sequence

52 -  

uaggaacuucauaccgugcucu

 - 73

Get sequence
Evidence experimental; Illumina [2]

References

1
"Computational Identification of MicroRNA Homologs from Acyrthosiphon pisum (Pea Aphid)" Sathyamurthy G, Swamy NR J. Comp. Intell. Bioinf. 2:109-119(2009).
2
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).