Stem-loop sequence aae-mir-277

AccessionMI0013435 (change log)
DescriptionAedes aegypti miR-277 stem-loop
Gene family MIPF0000156; mir-277
Literature search

1 open access papers mention aae-mir-277
(1 sentences)

Stem-loop
   ua           -   gu    -            ua      u cc 
5'   guuuuggagug cgu  caga agugcauuuaca  gguauu c  g
     ||||||||||| |||  |||| ||||||||||||  |||||| |  u
3'   uaagaccuuac gca  gucu ucacguaaaugu  uuauga g  u
   ac           a   ug    a            --      c au 
Get sequence
Deep sequencing
19177 reads, 900 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.265: 508799-508893 [+]
intergenic
Clustered miRNAs
< 10kb from aae-mir-277
aae-mir-277supercont1.265: 508799-508893 [+]
aae-mir-34supercont1.265: 509521-509649 [+]
Database links

Mature sequence aae-miR-277-5p

Accession MIMAT0014210
Previous IDsaae-miR-277*
Sequence

14 - 

cgugucagaagugcauuuaca

 - 34

Get sequence
Deep sequencing245 reads, 2 experiments
Evidence experimental; Illumina [2]

Mature sequence aae-miR-277-3p

Accession MIMAT0014211
Previous IDsaae-miR-277
Sequence

62 - 

uaaaugcacuaucugguacgac

 - 83

Get sequence
Deep sequencing18904 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).