Stem-loop sequence aae-mir-8

AccessionMI0013437 (change log)
DescriptionAedes aegypti miR-8 stem-loop
Gene family MIPF0000019; mir-8
Literature search

3 open access papers mention aae-mir-8
(4 sentences)

Stem-loop
   gucu    -----       -   g     c      --    u 
5'     guuc     acaucuu acc ggcag auuaga  uauu u
       ||||     ||||||| ||| ||||| ||||||  |||| u
3'     caag     uguagaa ugg cuguc uaaucu  auaa g
   ----    ccugc       a   a     a      uc    a 
Get sequence
Deep sequencing
221120 reads, 1.07e+04 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.411: 876043-876121 [+]
intergenic
Database links

Mature sequence aae-miR-8-5p

Accession MIMAT0014214
Previous IDsaae-miR-8*
Sequence

10 - 

caucuuaccgggcagcauuaga

 - 31

Get sequence
Deep sequencing75201 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-8-3p

Accession MIMAT0014215
Previous IDsaae-miR-8
Sequence

49 - 

uaauacugucagguaaagauguc

 - 71

Get sequence
Deep sequencing145919 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).