Stem-loop sequence aae-mir-252

AccessionMI0013438 (change log)
DescriptionAedes aegypti miR-252 stem-loop
Gene family MIPF0000285; mir-252
Literature search

3 open access papers mention aae-mir-252
(6 sentences)

Stem-loop
   ga       ac        a u  c     agaga 
5'   auucuuu  uaaguacu g gc gcagg     u
     |||||||  |||||||| | || |||||     u
3'   ugagaag  auucguga c cg cgucc     u
   --       cu        a c  u     ccaag 
Get sequence
Deep sequencing
50361 reads, 2.5e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.56: 1580021-1580091 [-]
intergenic
Database links

Mature sequence aae-miR-252-5p

Accession MIMAT0014216
Previous IDsaae-miR-252
Sequence

12 - 

uaaguacuagugccgcaggag

 - 32

Get sequence
Deep sequencing50105 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-252-3p

Accession MIMAT0014217
Previous IDsaae-miR-252*
Sequence

45 - 

cugcugcccaagugcuuaucg

 - 65

Get sequence
Deep sequencing255 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).